STEWART LABORATORY

---

 

       OLIGONUCLEOTIDE LIGATION ASSAY FOR TELOMERIC G-rich 3’-overhang

       (Adapted from Cimino-Reale et al., NAR 2001, 29(7):e35)

 

 

PREPARE HIGH MOLECULAR WEIGHT DNA

                                   

We do several steps:

 

§                overnight at 37°C in the presence of proteinase K

 

§                1X Phenol

 

§                1X Phenol:Chloroform (1:1)

 

§                1X Chloroform

 

 

 

TREAT PREPARED HMW DNA WITH RNase (DNase-FREE) 

 

§                Run treated DNA out on a 1.0% gel to ensure that there is NO RNA contamination (the presence of RNA causes many problems with this assay)

 

·        Phenol:Chloroform (1:1)

 

·        1X Chloroform

 

·        Re-suspend DNA in ddH20 overnight at RT

 

 

 

TREAT 7 μg OF DNA WITH Bal31 NUCLEASE

(this method should initially be validated by also treating DNA with S1 nuclease, T7(Gene6) Exonuclease and Exonuclease III, and Exo I [Exo1
treatment needs to be done overnight and must be calibrated for the enzyme that you are using. We’ve seen quite a bit of variation with this])

 

 

                                                                  1.            Digest in 100 μL reaction (you want 3 units of Bal31 nuclease per 100 μL reaction)

 

                                                                  2.            Digest at 30°C for 15 min

 

                                                                  3.            Phenol:Chloroform

 

                                                                  4.            Chloroform

 

                                                                  5.            Add 11 μL of 5M NaCl

 

                                                                  6.            Add 300 μL 100% EtOH

 

                                                                  7.            Spin 15 min at 4°C

 

                                                                  8.            Wash with 70% EtOH

 

                                                                  9.            Air dry

 

                                                             10.            Re-suspend in 12 μL ddH2O

 

                                                             11.            OD 2 μL of the DNA at 1:50

 

 

LABEL YOUR OLIGO
(this is for both the matched oligo, (CCCTAA)4, and the mismatched oligo, (CCCTTA) 4, You will need 3.2 μL of oligo for each reaction). This is a sample reaction that
yields 50 μL (i.e. enough for 15 reactions)

 

§                Mix:

 

§         4 μL oligo at 2μM

 

§         5 μL 10x PNK buffer

 

§         15 μL ddH2O

 

§         24 μL gamma ATP (3000 Ci/mmol, 10mCi/mL)

 

§         2 μL PNK

                                   

40 min at 37°C

 

                                                                  1.            Add

 

§         1 µL 0.1M cold rATP

 

§         1 μL PNK

 

                                                20 min at 37°C

 

                                                                  2.            Pass the labeled oligo through a G25 column (2x)

 

                                                                  3.            Check the specificity (you want it to be 1 x 106 or higher)

 

 

PREPARE YOUR REACTIONS IN DUPLICATE
(GM847 DNA makes a great positive-control)

 

                                                                  1.            The total reaction volume is 20 μL

 

                                                                  2.            Mix:

 

§         5 μg of RNA-free DNA and add ddH2O to 14.3 μL

 

§         2 μL 10X Taq ligase buffer

 

§         3.2 μL labeled oligo (you want 0.5 pM of oligo per reaction)

 

 

                                                                  3.            Place the tube at 50°C for 12-14 hr (use an oven, if you put it in a waterbath it will evaporate)

 

                                                                  4.            Quick spin the tube and add 0.5 μL Taq ligase

 

                                                                  5.            Incubate another 5 hr at 50°C

 

                                                                  6.            Add 80 μL ddH2O (containing ddH2O and 5M NaCl at a 7:1 ratio)

 

                                                                  7.            Add 200 μL 100% EtOH

 

                                                                  8.            Spin for 15 min at max speed

 

                                                                  9.            Wash with 70% EtOH (spin for another 5 min as the pellet often slips down the side of the tube and allow to air dry)

 

                                                             10.            Re-suspend in 10 μL ddH2O and place at 50°C for 2 to 3 hours (or at 37°C, overnight)

 

 

PREPARE SAMPLES FOR GEL SEPARATION:

 

                                                                  1.            Add 10 μl 2x denaturing DNA loading dye from Ambion

 

                                                                  2.            Heat sample to 95oC for 5’ and crash on ice, quick spin

 

                                                                  3.            OD your samples (remember that the blank should have 1X loading dye that was heated in a similar fashion to the samples)

 

                                                                  4.            Aliquot equal concentrations of DNA and equalize the volumes

 

                                                                  5.            Heat sample to 95°C for 5 min and crash on ice, quick spin

 

                                                                  6.            Load samples onto a 5% Urea-TBE gel.  We usually run the first dye to about 1” from the bottom.  We run sequencing sized gels as the resolution on the smaller
gels isn’t good enough to do robust densitometry

 

                                                                  7.            Dry down the gels and expose (be sure to use the BioMax MS film and the HE Transcreens at -70°C)

 

 

DILUTE SAMPLES TO 5 ng/μL AND RUN A GAPDH PCR
(This insures that your ODs were accurate)

 

*                  Primers used for amplifying GAPDH:

 

*      5’GACCCCTTCATTGACCTCAAC3’

 

*       5’CTTCTCCATGGTGGTGAAGA3’